Skip to main content

1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
(Plasmid #121482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121482 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEMBL8
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    S. Aureus Cas9
  • gRNA/shRNA sequence
    gggtcttcacgcgtgaagacCa
  • Promoter HLP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ccctgtttgctcctccgataac
  • 3′ sequencing primer cattagatctgtgtgttggttttttgtgtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA was a gift from William Lagor (Addgene plasmid # 121482)
  • For your References section:

    A Self-Deleting AAV-CRISPR System for In Vivo Genome Editing. Li A, Lee CM, Hurley AE, Jarrett KE, De Giorgi M, Lu W, Balderrama KS, Doerfler AM, Deshmukh H, Ray A, Bao G, Lagor WR. Mol Ther Methods Clin Dev. 2018 Dec 6;12:111-122. doi: 10.1016/j.omtm.2018.11.009. eCollection 2019 Mar 15. 10.1016/j.omtm.2018.11.009 PubMed 30619914