1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
(Plasmid
#121482)
-
PurposeAAV cloning backbone encoding S. Aureus Cas9 driven by HLP and gRNA driven by U6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEMBL8
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS. Aureus Cas9
-
gRNA/shRNA sequencegggtcttcacgcgtgaagacCa
- Promoter HLP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ccctgtttgctcctccgataac
- 3′ sequencing primer cattagatctgtgtgttggttttttgtgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA was a gift from William Lagor (Addgene plasmid # 121482) -
For your References section:
A Self-Deleting AAV-CRISPR System for In Vivo Genome Editing. Li A, Lee CM, Hurley AE, Jarrett KE, De Giorgi M, Lu W, Balderrama KS, Doerfler AM, Deshmukh H, Ray A, Bao G, Lagor WR. Mol Ther Methods Clin Dev. 2018 Dec 6;12:111-122. doi: 10.1016/j.omtm.2018.11.009. eCollection 2019 Mar 15. 10.1016/j.omtm.2018.11.009 PubMed 30619914