-
PurposeIntegration vector that expresses gfp in S. mutans
-
Depositing Lab
-
Depositing OrganizationUniversity of Florida
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 121503-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 121503-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMZ
- Total vector size (bp) 7666
-
Modifications to backboneRemoved PaguR promoter / lacZ gene
-
Vector typeS. mutans integration vector, integrates at the mtlA-phnA locus
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor E. coli, grow in Lysogeny broth (LB) containing 50μg/mL kanamycin or 300μg/mL erythromycin. For S. mutans, select with 1000μg/mL kanamycin on agar plates. Other streptococci may require selection on lower amounts of kanamycin (e.g. 500μg/mL).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuperfolder GFP
-
Alt namesfgfp
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDMK301203
- Promoter Pveg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site SphI (unknown if destroyed)
- 5′ sequencing primer mtlA: CAGTCTTAGTCAGGCTTTG
- 3′ sequencing primer phnA: GATTCCATTCATAAGCACAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 121503-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 121503-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPM_Pveg-sfgfp was a gift from Robert Shields (Addgene plasmid # 121503 ; http://n2t.net/addgene:121503 ; RRID:Addgene_121503) -
For your References section:
Fluorescence tools adapted for real-time monitoring of the behaviors of Streptococcus species. Shields RC, Kaspar JR, Lee K, Underhill SAM, Burne RA. Appl Environ Microbiol. 2019 May 17. pii: AEM.00620-19. doi: 10.1128/AEM.00620-19. 10.1128/AEM.00620-19 PubMed 31101614