pBABE-RSLID1(WT)
(Plasmid #122296)

• Purpose: expresses RSL1D1 protein in mammalian cells (puro resistance)
• Depositing Lab: Gerardo Ferbeyre
• Publication: Lessard et al Nat Cell Biol. 2018 Jul;20(7):789-799. doi: 10.1038/s41556-018-0127-y. Epub 2018 Jun 25.

Backbone

• Vector backbone: pBABE-puro
• Backbone size w/o insert (bp): 5170
• Total vector size (bp): 6630
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RSL1D1
• Species: H. sapiens (human)
• GenBank ID: NM_015659
• Entrez Gene: RSL1D1 (a.k.a. CSIG, L12, PBK1, UTP30)
• Promoter: vector's LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cccttgaacctcctcgttcgacc (Forward sequencing primer)
• 3′ sequencing primer: ggactttccacacctggttgct (Reverse sequencing primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry