Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLOX-CW-CRE Notes

Sequence with SP6 primer

Dr. Bailing Li from the University of Cincinnati obtained the following sequence using the SP6 primer. This sequence matches AF029320 (Homo sapiens 3' chromosomal flanking sequence of HIV-1 proviral vector, pHXB2gpt). The Trono lab sequence is missing this region.

SEQ_START
>pLOX-CW-CRE with SP6
CTAATAGNNTGTAAATGCTAAATAAAGTTGTTATACTGTGCTGTTTTTCTGATTTGTATTTTTTTATTGTTGTATTGCTATTTTTAATTTTTTCCCAATATTTTTGATCCACAGTTGGTTGGATTTTTGTTGTGGAACCTGCAGATGAGGAAGGCTGACTTTATATGATAATATCAAACTGGAAAAATTGATGTTAGAATAAAGATGTGTTTCTGAGATTAAATTAGATTTTAATAAAAATTACCCCAGTCTCAGGTTTTCTATCTGCAATGTGAAATGATCTCAGAGAAGAATAAATTTTAACCATTTACATTATTAAATTGAAATCACTAAAAGTAAAACAAAGGTGTGAGACTATATAATAGATTGTTTTCCTTATTTCAGAGTCTTTGGAACAAATTCTTCCAAGATAAAGAACTTCGATCAATGATTGAACAAGATGTCAAAAGAACGTATGTAGAACTATTTACATGTTACTTTCAATAATTCAAATTGTTGTTATCTCTTTCTAATTTTAACAAAACACAAAATCTGCAGTCAACTTAATTGAATGCAGTATTCTACTTGTGTTAATAACAAACTTGTTTTGACAAATTGTGATAATAAGGATTGTTTTCTACTCTAATGATACACATTTCTATGTTCCCTTTTTAAAAGTAAATTACATTTATAATATTGATAATCTTCAATAATATTTAATTAGTTTTATCAAGTTCCAACAATTATTTGAAGTCATATTTAAGGTTATATTGTATAGTCTTGTTGCCAGAAAAATTTATCCCTTGCTTTATGCATTTGAATCCCTTTCTAACCAAGTTACTTGTTAAAAC
SEQ_END

Restriction digest of pLOX-CW-CRE

Dr. Bailing Li from the University of Cincinnati submitted the gel image. The ladder is the NEB 1Kb ladder: 10, 8, 6, 5, 4 kb from the top.

Addgene diagnostic digest

This gel depicts the NEB 1kb ladder and a digestion of the plasmid with the following enzymes: XbaI+BamHI double digest

We expected the following band sizes for this digest: 8.2kb and 1.7kb. We do not see the expected pattern. Instead we see 8kb, 3.5kb and faint 0.4kb bands. Depositing lab is aware of the discrepancy and attributes it to mistakes during sequence assembly for the full plasmid.