Skip to main content

mIL12-N1
(Plasmid #123139)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123139 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 123139-D50 50 μg of DNA in Tris buffer $495
DNA 123139-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    N1
  • Backbone manufacturer
    clonTech
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5685
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine IL12 tandem p40 p35
  • Alt name
    mIL-12
  • Alt name
    p40
  • Alt name
    p35
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1773
  • GenBank ID
    16159 16160
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PvuI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mIL12-N1 was a gift from Jordan Green (Addgene plasmid # 123139 ; http://n2t.net/addgene:123139 ; RRID:Addgene_123139)
  • For your References section:

    In situ genetic engineering of tumors for long-lasting and systemic immunotherapy. Tzeng SY, Patel KK, Wilson DR, Meyer RA, Rhodes KR, Green JJ. Proc Natl Acad Sci U S A. 2020 Feb 7. pii: 1916039117. doi: 10.1073/pnas.1916039117. 10.1073/pnas.1916039117 PubMed 32034097