pEF1a_CD MUT TET1
(Plasmid
#124083)
-
PurposeExpression of mutated catalytic domain only form of TET1
-
Depositing Lab
-
Depositing OrganizationInstitute for Research in Biomedicine, Switzerland
Located in Switzerland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124083 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 124083-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 124083-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF1 alpha
- Backbone size w/o insert (bp) 6181
- Total vector size (bp) 8857
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET1 - catalytic domain mutated
-
Alt nameTen Eleven Translocation methylcytosine dioxygenase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2676
-
MutationH1672Y, D1674A
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter EF1 alpha
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid expressing wild type full length form of TET1 was taken from addgene (#49792)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The two mutations listed before (H1672Y, D1674A) were introduced using the
QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).
DNA (Catalog # 124083-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 124083-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a_CD MUT TET1 was a gift from Silvia Monticelli (Addgene plasmid # 124083 ; http://n2t.net/addgene:124083 ; RRID:Addgene_124083) -
For your References section:
The contribution of active and passive mechanisms of 5mC and 5hmC removal in human T lymphocytes is differentiation- and activation-dependent. Vincenzetti L, Leoni C, Chirichella M, Kwee I, Monticelli S. Eur J Immunol. 2019 Jan 30. doi: 10.1002/eji.201847967. 10.1002/eji.201847967 PubMed 30698829