pEF1a_FL MUT TET1
(Plasmid
#124081)
-
PurposeExpression of catalytic inactive form of full-length TET1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEF1 alpha
- Backbone size w/o insert (bp) 6100
- Total vector size (bp) 12598
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET1 - full length, mutated
-
Alt nameTen Eleven Translocation methylcytosine dioxygenase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6492
-
MutationH1672Y, D1674A
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter EF1 alpha
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTAGAATTGATCCAAGCTCTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid expressing wild type full length form of TET1 was taken from addgene (#49792)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The two mutations listed before (H1672Y, D1674A) were introduced using the
QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a_FL MUT TET1 was a gift from Silvia Monticelli (Addgene plasmid # 124081 ; http://n2t.net/addgene:124081 ; RRID:Addgene_124081) -
For your References section:
The contribution of active and passive mechanisms of 5mC and 5hmC removal in human T lymphocytes is differentiation- and activation-dependent. Vincenzetti L, Leoni C, Chirichella M, Kwee I, Monticelli S. Eur J Immunol. 2019 Jan 30. doi: 10.1002/eji.201847967. 10.1002/eji.201847967 PubMed 30698829