Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUCC001
(Plasmid #124451)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124451 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUDP002
  • Backbone manufacturer
    TU Delft
  • Backbone size w/o insert (bp) 9106
  • Total vector size (bp) 10233
  • Modifications to backbone
    Insert 1 cloned by Gibson assembly between the existing ScTDH3 promoter and ScCYC1 terminator
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HH-BsaI
  • Alt name
    HH-gRNA-HDV expression cassette
  • Species
    Synthetic
  • Insert Size (bp)
    1136
  • Mutation
    gRNA expression cassette from pUDP002 modified to allow cloning of gRNA targets by Golden Gate assembly
  • Promoter TDH3 promoter from S.cerevisiae (already present in backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGCTCTCTCTGATTTGGAAAAAGCTGAA
  • 3′ sequencing primer TACACGCGTTTGTACAGAAAAAAAAGAAAAATTTGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The same patent and IP restrictions as in pUDP002 apply here.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCC001 was a gift from John Morrissey (Addgene plasmid # 124451 ; http://n2t.net/addgene:124451 ; RRID:Addgene_124451)
  • For your References section:

    Biological Parts for Kluyveromyces marxianus Synthetic Biology. Arun S. Rajkumar, Javier A. Varela, Hannes Juergens, Jean-Marc G. Dara2 and John P. Morrissey. Front. Bioeng. Biotechnol., 07 May 2019 10.3389/fbioe.2019.00097