Skip to main content
Addgene
Open Menu

pTagGFP2-N SIN1 deltaPH
(Plasmid #124922)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124922 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 124922-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 124922-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pTagGFP2-N
  • Backbone manufacturer
    Evrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAPKAP1
  • Alt name
    SIN1
  • Alt name
    mSIN1
  • Species
    H. sapiens (human)
  • Mutation
    Insert ORF was sirently mutated to be resistent to sgMAPKAP1_1.
  • Entrez Gene
    MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
  • Tag / Fusion Protein
    • TagGFP2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TagGFP-Rev, GCGCACGCTGAACTTGTGGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTagGFP2-N SIN1 deltaPH was a gift from Jin Chen (Addgene plasmid # 124922 ; http://n2t.net/addgene:124922 ; RRID:Addgene_124922)

  • For your References section:

    Disruption of the Scaffolding Function of mLST8 Selectively Inhibits mTORC2 Assembly and Function and Suppresses mTORC2-Dependent Tumor Growth In Vivo. Hwang Y, Kim LC, Song W, Edwards DN, Cook RS, Chen J. Cancer Res. 2019 Jul 1;79(13):3178-3184. doi: 10.1158/0008-5472.CAN-18-3658. Epub 2019 May 13. 10.1158/0008-5472.CAN-18-3658 PubMed 31085701
Related items:
Commonly requested with: