Skip to main content

pH3U3-Zif268
(Plasmid #12610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12610 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    PH3U3-mcs
  • Backbone size w/o insert (bp) 5821
  • Vector type
    Bacterial Expression
  • Selectable markers
    URA3, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Zif268 binding site in pH3U3
  • Insert Size (bp)
    21

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAAATATGTATCCGCTCATGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH3U3-Zif268 was a gift from Scot Wolfe (Addgene plasmid # 12610 ; http://n2t.net/addgene:12610 ; RRID:Addgene_12610)
  • For your References section:

    A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365