Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #12609)


Item Catalog # Description Quantity Price (USD)
Plasmid 12609 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5790
  • Vector type
    Bacterial Expression
  • Selectable markers
    URA3, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Multiple cloning site in His3 Ura3 reporter plasmid
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAAATATGTATCCGCTCATGAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that the cloning information for this plasmid has been corrected as of 1/14/09. The 5' cloning site was changed from MluI to NotI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH3U3-mcs was a gift from Scot Wolfe (Addgene plasmid # 12609 ; ; RRID:Addgene_12609)
  • For your References section:

    A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365