Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pB1H1
(Plasmid #12611)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 12611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pB1H1
  • Backbone size w/o insert (bp) 3598
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dorsal RHR in pB1H1
  • Alt name
    dorsal
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    887
  • GenBank ID
    CG6667
  • Entrez Gene
    dl (a.k.a. Dmel_CG6667, CG6667, DL, Dl, Dmel\CG6667, Dor, Dorsal, GSd447, NF-KB, NF-kappaB, NFkappaB, anon-EST:GressD7, d, dL, fs(2)k10816, mat(2)dorsal, p65)
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer GATTCGTCGTGCGGCAACCA
  • 3′ sequencing primer GCGCTTCGTTAATACAGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB1H1 was a gift from Scot Wolfe (Addgene plasmid # 12611 ; http://n2t.net/addgene:12611 ; RRID:Addgene_12611)
  • For your References section:

    A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365