-
PurposeGlobal labeling of excitatory synapses (green fluorescence)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 9247
- Total vector size (bp) 10854
-
Modifications to backboneInserted CCR5TC DNA binding sequence upstream of promoter.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePSD95.FingR-eGFP-CCR5TC
-
Insert Size (bp)1596
- Promoter CamKIIa
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTGAGCAGCCACAGTGC
- 3′ sequencing primer CCAGTCAATCTTTCACAAAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPart of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-CamKII-PSD95.FingR-eGFP-CCR5TC was a gift from Xue Han (Addgene plasmid # 126218 ; http://n2t.net/addgene:126218 ; RRID:Addgene_126218) -
For your References section:
A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057