pTBL437 AAVS1 EQR sgRNA
(Plasmid
#126447)
-
PurposeTo cut the human AAVS1 locus for integration.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Irvine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 126447-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 126447-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSQT1313
-
Backbone manufacturerKeith Joung
- Backbone size w/o insert (bp) 2259
- Total vector size (bp) 2279
-
Modifications to backboneThe backbone was modified to express only one sgRNA.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namespacer against human AAVS1 safe-harbor locus with NGAG PAM
-
gRNA/shRNA sequencetagtggccccactgtggggt
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter human U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer CGGACAGGTATCCGGTAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKeith Joung; the backbone was created from pSQT1313, Addgene #53370.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320.
To integrate at HEK293 site 3, co-transfect with a homology donor (for example, pTBL681, Addgene #126449) and MSP680 from Keith Joung's group, Addgene #65772. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.
DNA (Catalog # 126447-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 126447-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL437 AAVS1 EQR sgRNA was a gift from Chang Liu (Addgene plasmid # 126447 ; http://n2t.net/addgene:126447 ; RRID:Addgene_126447) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928
Map uploaded by the depositor.
