pTBL680 CHYRON3 integration construct
(Plasmid
#126448)
-
PurposeTo integrate the CHYRON3 locus at AAVS1 in human cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4560
- Total vector size (bp) 6642
-
Modifications to backboneAdded homology arms to target the insert to AAVS1 and insulator sequences between the homology arms and the insert.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepU6/3xLacO-CHYRON3 hgRNA
-
SpeciesH. sapiens (human); Streptococcus pyogenes
-
Insert Size (bp)507
-
MutationThe SpCas9 sgRNA constant region is mutated to make it self-targeting.
-
GenBank ID
- Promoter human U6/3xLacO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGGTCGGGCAGGAAGAGGG
- 3′ sequencing primer TATGTAGAGAGGTACCTCGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepCMV-puro
-
Alt namepuromycin N-acetyltransferase
-
SpeciesStreptomyces sp.
-
Insert Size (bp)1575
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTimothy Lu; the stgRNA expression cassette is from Addgene #81254.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insulator sequence is described in Liu et al., 2015, doi: 10.1038/nbt.3062.
To integrate in human cells, digest with EcoRI and co-transfect with Addgene plasmids 126447 and 65772. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL680 CHYRON3 integration construct was a gift from Chang Liu (Addgene plasmid # 126448 ; http://n2t.net/addgene:126448 ; RRID:Addgene_126448) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928