pTBL680 CHYRON3 integration construct
(Plasmid #126448)

• Purpose: To integrate the CHYRON3 locus at AAVS1 in human cells.
• Depositing Lab: Chang Liu
• Publication: Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4560
• Total vector size (bp): 6642
• Modifications to backbone: Added homology arms to target the insert to AAVS1 and insulator sequences between the homology arms and the insert.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: pU6/3xLacO-CHYRON3 hgRNA
• Species: H. sapiens (human); Streptococcus pyogenes
• Insert Size (bp): 507
• Mutation: The SpCas9 sgRNA constant region is mutated to make it self-targeting.
• GenBank ID:
• Promoter: human U6/3xLacO

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAGGTCGGGCAGGAAGAGGG
• 3′ sequencing primer: TATGTAGAGAGGTACCTCGAGC

Gene/Insert 2

• Gene/Insert name: pCMV-puro
• Alt name: puromycin N-acetyltransferase
• Species: Streptomyces sp.
• Insert Size (bp): 1575
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: SV40pA-R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Timothy Lu; the stgRNA expression cassette is from Addgene #81254.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insulator sequence is described in Liu et al., 2015, doi: 10.1038/nbt.3062.

To integrate in human cells, digest with EcoRI and co-transfect with Addgene plasmids 126447 and 65772. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.