Skip to main content

pDmelOR-mRho.V5.mER.hOr56a
(Plasmid #126479)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126479 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 126479-D50 50 μg of DNA in Tris buffer $495
DNA 126479-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-BI
  • Backbone size w/o insert (bp) 4111
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Or56a
  • Alt name
    DmelOr56a
  • Alt name
    Odorant receptor 56a
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1338
  • Mutation
    codon optimization for H. sapiens
  • Entrez Gene
    Or56a (a.k.a. Dmel_CG12501, 56E.1, 56a, CG12501, DOR59, DmOr56a, Dmel\CG12501, OR56a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • H. sapiens Rhodopsin 344QVAPA348 (mRho) (N terminal on insert)
    • V5 tag (N terminal on insert)
    • H. sapiens HCN1 106VNKFSL111 (mER) (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer CATTTTATGTTTCAGGTTCAGGGGG
  • 3′ sequencing primer GGCCTATATAAGCAGAGCTCGTTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Orco
  • Alt name
    DmelOrco
  • Alt name
    Olfactory receptor co-receptor
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1509
  • Mutation
    codon optimization for H. sapiens; including a recombinant β-globin/IgG chimeric intron
  • Entrez Gene
    Orco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Is it recommended to digest the vector with XhoI and NaeI and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDmelOR-mRho.V5.mER.hOr56a was a gift from Bill Hansson (Addgene plasmid # 126479 ; http://n2t.net/addgene:126479 ; RRID:Addgene_126479)
  • For your References section:

    Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297