pSG019
(Plasmid #126502)

• Purpose: Pseudomonas aeruginosa disaggregase ClpG cloned as ClpG-6xHis
• Depositing Lab: Ute Romling
• Publication: Lee et al Proc Natl Acad Sci U S A. 2018 Jan 9;115(2):E273-E282. doi: 10.1073/pnas.1712051115. Epub 2017 Dec 20.

Backbone

• Vector backbone: pJN105
• Backbone size w/o insert (bp): 6055
• Total vector size (bp): 8838
• Vector type: Bacterial Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Growth instructions: different temperatures possible; alternative E. coli K-12 derivatives can be used as hosts; used for protein production in original host Pseudomonas aeruginosa SG17M
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: disaggregase ClpG with 6xHis-tag
• Species: Pseudomonas aeruginosa SG17M
• Insert Size (bp): 2843
• GenBank ID: taxi:1443105 (genome) EWH25562.1 (protein)
• Promoter: PBAD
• Tag / Fusion Protein:
  • C-terminal 6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CCATAGCATTTTTATCCATAAG
• 3′ sequencing primer: AAACGACGGCCAGTGAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry