Skip to main content

pLentiCRISPRv2-NONO 40
(Plasmid #127653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127653 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NONO sgRNA
  • gRNA/shRNA sequence
    GTAGTCATTGTGGATGATCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    NONO (a.k.a. MRXS34, NMT55, NRB54, P54, P54NRB, PPP1R114)

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-NONO 40 was a gift from Nicolas Manel (Addgene plasmid # 127653 ; http://n2t.net/addgene:127653 ; RRID:Addgene_127653)
  • For your References section:

    NONO Detects the Nuclear HIV Capsid to Promote cGAS-Mediated Innate Immune Activation. Lahaye X, Gentili M, Silvin A, Conrad C, Picard L, Jouve M, Zueva E, Maurin M, Nadalin F, Knott GJ, Zhao B, Du F, Rio M, Amiel J, Fox AH, Li P, Etienne L, Bond CS, Colleaux L, Manel N. Cell. 2018 Oct 4;175(2):488-501.e22. doi: 10.1016/j.cell.2018.08.062. Epub 2018 Sep 27. 10.1016/j.cell.2018.08.062 PubMed 30270045