pLentiCRISPRv2-NONO 4
(Plasmid
#127652)
-
PurposeKnock-out of human NONO
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLentiCRISPRv2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNONO sgRNA
-
gRNA/shRNA sequenceGTATGTGTCCAACGAACTGC
-
SpeciesH. sapiens (human)
-
Entrez GeneNONO (a.k.a. MRXS34, NMT55, NRB54, P54, P54NRB, PPP1R114)
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-NONO 4 was a gift from Nicolas Manel (Addgene plasmid # 127652 ; http://n2t.net/addgene:127652 ; RRID:Addgene_127652) -
For your References section:
NONO Detects the Nuclear HIV Capsid to Promote cGAS-Mediated Innate Immune Activation. Lahaye X, Gentili M, Silvin A, Conrad C, Picard L, Jouve M, Zueva E, Maurin M, Nadalin F, Knott GJ, Zhao B, Du F, Rio M, Amiel J, Fox AH, Li P, Etienne L, Bond CS, Colleaux L, Manel N. Cell. 2018 Oct 4;175(2):488-501.e22. doi: 10.1016/j.cell.2018.08.062. Epub 2018 Sep 27. 10.1016/j.cell.2018.08.062 PubMed 30270045