Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX330-NEAT1pr_v1
(Plasmid #97081)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 97081 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA NEAT1pr_v1
  • gRNA/shRNA sequence
    CACCGGCTATAAAAGCAAAAGTTG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-NEAT1pr_v1 was a gift from Archa Fox (Addgene plasmid # 97081 ; http://n2t.net/addgene:97081 ; RRID:Addgene_97081)
  • For your References section:

    Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. Li R, Harvey AR, Hodgetts SI, Fox AH. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116. 10.1261/rna.059477.116 PubMed 28325845