Mouse 3' Ubf AID GFP PuroR
(Plasmid #127901)

• Purpose: HDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Mouse Ubf Gene
• Depositing Lab: Mark Groudine
• Publication: Plasmids for generating AID/Degron Cell Lines in Human and Mouse (unpublished)

Backbone

• Vector backbone: pBSK
• Vector type: Donor plasmid
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ubf
• Alt name: upstream binding transcription factor
• Alt name: Ubtf
• Species: M. musculus (mouse), A. thaliana (mustard weed)
• Insert Size (bp): 2097
• Mutation: Inserting GFP AID 2A Puro into mouse 3' Ubf
• GenBank ID: NC_000077.6
• Entrez Gene: Ubtf (a.k.a. A930005G04Rik, NOR-90, Tcfubf, UBF, UBF-1, UBF1)
• Tag / Fusion Protein:
  • GFP, AID, PuroR

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgctgcaaggcgattaagttgg

Resource Information

• Supplemental Documents:
  • Mouse 3' Ubf AID GFP 2A PuroR.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry