pKF-P14MM2AG5h
(Plasmid #128254)

• Purpose: Mammalian positive feedback synthetic gene circuit within a Flp-In expression vector.
• Depositing Lab: Gabor Balazsi
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.

Backbone

• Vector backbone: pcDNA5/FRT
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5070
• Total vector size (bp): 6246
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rtTA-Advanced::P2A::EGFP
• Alt name: reverse tetracycline Transactivator
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 1877
• Promoter: tight TRE promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ATATACGCGTCGAGGCCCTTTC
• 3′ sequencing primer: GATCCTTACTTGTACAGCTCGTCCATGC

Resource Information

• Supplemental Documents:
  • pKF-P14MM2AG5h
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid encodes a mammalian synthetic gene circuit that contains the regulator reverse tetracycline Trans Activator (rtTA) and the reporter EGFP, which is controlled by a tight TRE promoter that rtTA binds to activate its own expression in a positive feedback loop. The backbone consists of the Flp-In expression vector (pcDNA5/FRT). The synthetic gene circuit is also called mPF-GFP.