pQCXIP-mCherry-Halo-YAP1
(Plasmid #128336)

• Purpose: Retrovirus construct to express mCherry-Halo-YAP1
• Depositing Lab: Yutaka Hata
• Publication: Maruyama et al Mol Cancer Res. 2018 Feb;16(2):197-211. doi: 10.1158/1541-7786.MCR-17-0382. Epub 2017 Oct 23.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YAP1
• Species: H. sapiens (human)
• Insert Size (bp): 1520
• GenBank ID: 10413
• Entrez Gene: YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry and Halo-tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TACTTTCAGAGCGATAACGCG
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PCR was performed with the primers (H3244, 50-caattggcagaaatcggtactggctttccatc-30 and H3245, 50-acgcgtgaattccgcgttatcgctctgaaagta-30) on pHTN-Halo-tag vector (Promega) to amplify Halo-tag. The PCR product was digested with MfeI/MluI and ligated into EcoRI/MluI of pCIneomCherry to generate pCIneomCherry-Halo. MluI/NotI fragment from pCIneoFH-YAP1 was ligated into MluI/NotI sites of pCIneomCherry-Halo to generate pCIneomCherry-Halo-YAP1. NheI/NotI fragment from pCIneomCherry-Halo-YAP1 was ligated into XbaI/NotI of pQCXIP-EF to generate pQCXIP-mCherry-Halo-YAP1.