pCIneoLuc-PP2A
(Plasmid
#128349)
-
PurposeVector for LUMIER assay
-
Depositing Lab
-
Depositing OrganizationInstitute of Science Tokyo
Located in Japan -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128349-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128349-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePP2A
-
Alt namePTPA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1080
-
GenBank ID5524
-
Entrez GenePTPA (a.k.a. PARK25, PP2A, PPP2R4, PR53)
- Promoter CMV
-
Tag
/ Fusion Protein
- Luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gataggcacctattggtcttactgacat
- 3′ sequencing primer Gaacctgaaacataaaatgaat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PP2A insert contains a H804Q mismatch compared to the NCBI reference.
DNA (Catalog # 128349-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128349-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoLuc-PP2A was a gift from Yutaka Hata (Addgene plasmid # 128349 ; http://n2t.net/addgene:128349 ; RRID:Addgene_128349) -
For your References section:
A cell-based screening for TAZ activators identifies ethacridine, a widely used antiseptic and abortifacient, as a compound that promotes dephosphorylation of TAZ and inhibits adipogenesis in C3H10T1/2 cells. Kawano S, Maruyama J, Nagashima S, Inami K, Qiu W, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Nishina H, Hata Y. J Biochem. 2015 May 14. pii: mvv051. 10.1093/jb/mvv051 PubMed 25979969