pORTMAGE312B
(Plasmid #128969)

• Purpose: Broad-host-range KanR plasmid expressing PapRecT and EcMutL_E32K with Toluic acid induction
• Depositing Lab: George Church
• Publication: Broad-host-range plasmids for improved recombineering in Gammaproteobacteria (unpublished)

Backbone

• Vector backbone: pSEVA258
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 9839
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: PapRecT
• Species: P. aeruginosa
• Insert Size (bp): 747
• GenBank ID: WP_003088368
• Promoter: xylS-Pm

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATAAGTCCAGCCTTGCAAG
• 3′ sequencing primer: CACTAGTTCTTTGACTACCGACG

Gene/Insert 2

• Gene/Insert name: mutL E32K
• Alt name: Dominant-Negative MutL
• Species: E. coli
• Insert Size (bp): 1848
• Mutation: E32K
• GenBank ID: NP_418591
• Promoter: xylS-Pm

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATAAGTCCAGCCTTGCAAG
• 3′ sequencing primer: GTTCTGAACAAATCCAGATG

Resource Information

• Supplemental Documents:
  • pORTMAGE-312B.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry