Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCVbsd-PPARD-R314K
(Plasmid #130745)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130745 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pMSCVbsd
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPARD R314K
  • Species
    H. sapiens (human)
  • Mutation
    R314K
  • Entrez Gene
    PPARD (a.k.a. FAAR, NR1C2, NUC1, NUCI, NUCII, PPARB)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pMSCVseqfw (CCCTTGAACCTCCTCGTTCGACC)
  • 3′ sequencing primer pMSCVseqrv (GAGACGTGCTACTTCCATTTGTC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Generated by PCR mutagenesis. Please visit https://www.biorxiv.org/content/10.1101/525576v2 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVbsd-PPARD-R314K was a gift from Till Adhikary (Addgene plasmid # 130745 ; http://n2t.net/addgene:130745 ; RRID:Addgene_130745)
  • For your References section:

    PPARbeta/delta recruits NCOR and regulates transcription reinitiation of ANGPTL4. Legrand N, Bretscher CL, Zielke S, Wilke B, Daude M, Fritz B, Diederich WE, Adhikary T. Nucleic Acids Res. 2019 Oct 10;47(18):9573-9591. doi: 10.1093/nar/gkz685. 10.1093/nar/gkz685 PubMed 31428774