AAVS1 intron 1 gRNA as2
(Plasmid
#132394)
-
PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backbone
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 132394-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 132394-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerAddgene
- Total vector size (bp) 2280
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting AAVS1 intron 1
-
Alt nameAAVS1
-
Alt namePPP1R12C
-
SpeciesH. sapiens (human)
-
Entrez GenePPP1R12C (a.k.a. AAVS1, LENG3, MBS85, p84, p85)
- Promoter hU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGGACTATCATATGCTTACCGTAACTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 132394-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 132394-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1 intron 1 gRNA as2 was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 132394 ; http://n2t.net/addgene:132394 ; RRID:Addgene_132394) -
For your References section:
Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies. Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G. Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5. 10.21769/BioProtoc.3615 PubMed 33659578