pX459-sgAAVS1
(Plasmid
#184403)
-
PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184403-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184403-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX459
- Backbone size w/o insert (bp) 9158
- Total vector size (bp) 9178
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1-specific sgRNA
-
gRNA/shRNA sequenceGGGGCCACTAGGGACAGGAT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA 20 bp targeting sequence is specific for AAVS1. Express this plasmid in cultured human cells to induce Cas9-mediated cutting of AAVS1; include donor plasmid with AAVS1-specific homology arms to stably integrate DNA at AAVS1 locus.
DNA (Catalog # 184403-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184403-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-sgAAVS1 was a gift from Robert Bradley (Addgene plasmid # 184403 ; http://n2t.net/addgene:184403 ; RRID:Addgene_184403) -
For your References section:
Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation. Udy DB, Bradley RK. Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. 10.26508/lsa.202101217 PubMed 34880103
Map uploaded by the depositor.
