Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation.
Udy DB, Bradley RK
Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. PubMed Article
Udy DB, Bradley RK
Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. PubMed Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
184393 | pCMV-3XFLAG-renilla-luciferase-beta-globin-control | Transient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein |
184394 | pCMV-3XFLAG-renilla-luciferase-beta-globin-(39PTC) | Transient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein with PTC in beta-globin |
184395 | AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1 | Donor plasmid for stable integration of firefly luciferase control reporter at AAVS1 |
184396 | AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1 | Donor plasmid for stable integration of Renilla luciferase control reporter at AAVS1 |
184397 | AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1 | Donor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1 |
184398 | AAVS1-TetOn-3XFLAG-renilla-beta-globin-PTC39-AAVS1 | Donor plasmid for stable integration of Renilla luciferase NMD(+) PTC39 reporter at AAVS1 |
184403 | pX459-sgAAVS1 | pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT |