Addgene: Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation.

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation.
Udy DB, Bradley RK
Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. PubMed Article

Plasmids from Article

ID	Plasmid	Purpose
184393	pCMV-3XFLAG-renilla-luciferase-beta-globin-control	Transient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein
184394	pCMV-3XFLAG-renilla-luciferase-beta-globin-(39PTC)	Transient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein with PTC in beta-globin
184395	AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1	Donor plasmid for stable integration of firefly luciferase control reporter at AAVS1
184396	AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1	Donor plasmid for stable integration of Renilla luciferase control reporter at AAVS1
184397	AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1	Donor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1
184398	AAVS1-TetOn-3XFLAG-renilla-beta-globin-PTC39-AAVS1	Donor plasmid for stable integration of Renilla luciferase NMD(+) PTC39 reporter at AAVS1
184403	pX459-sgAAVS1	pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT

Antibodies from Article