Skip to main content

AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1
(Plasmid #184395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184395 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 184395-D50 50 μg of DNA in Tris buffer $495
DNA 184395-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 9318
  • Total vector size (bp) 12349
  • Vector type
    Mammalian Expression, CRISPR ; Donor plasmid for HDR
  • Selectable markers
    Neomycin (select with G418), Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase beta-globin
  • Alt name
    Firefly luciferase control reporter
  • Species
    H. sapiens (human), M. musculus (mouse); Photinus pyralis
  • Insert Size (bp)
    3031
  • Promoter Tet-On 3G
  • Tag / Fusion Protein
    • 3X FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer AGTGCAGGTGCCAGAACATT
  • 3′ sequencing primer CAGCTCCTGGGCAATATGAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The 3X-FLAG firefly luciferase beta-globin insert sequence is from a plasmid from James Inglese's lab (Addgene catalog # 112085, published in PMID: 29528287).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The backbone is from a plasmid from Masato Kanemaki’s lab (Addgene catalog # 72835, published in PMID: 27052166). The 3X-FLAG firefly luciferase beta-globin insert sequence replaces the OsTIR1 sequence in that plasmid. Additional cloning details are available in Udy et al., 2021 (PMID: 34880103).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1 was a gift from Robert Bradley (Addgene plasmid # 184395 ; http://n2t.net/addgene:184395 ; RRID:Addgene_184395)
  • For your References section:

    Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation. Udy DB, Bradley RK. Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. 10.26508/lsa.202101217 PubMed 34880103