Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies.
Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G
Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5.
PubMed Article

Plasmids from Article

ID Plasmid Purpose
132388AAVS1 KanR foundation lox casetteFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locus
132389AAVS1 CAG rtTA3 TauWT 2N4R-EGFPExchange cassette containing inducible TauWT 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 site
132393AAVS1 CAG rtTA3 TauP301L 2N4R-EGFPExchange cassette containing inducible TauP301L 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 site
132394AAVS1 intron 1 gRNA as2Targets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backbone
132395AAVS1 intron 1 gRNA s3Targets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backbone
132396AAVS1 intron 1 gRNA 27Targets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backbone

Antibodies from Article