-
PurposeExchange cassette containing inducible TauWT 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 site
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAVS1-T2A-Puro-Cas9-TREtight
-
Backbone manufacturerAddgene
- Total vector size (bp) 8048
-
Vector typeMammalian Expression, Cre/Lox, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBacteria may truncate DNA, please select multiple clones and perform restriction digest after purification to confirm.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman TauWT 2N4R-EGFP
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneMAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
- Promoter TREtight
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbvCI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TTCAGGTTGGACCGGTCCTCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a 55 basepair deletion in the poly-GC track of the CAG promoter. It is unknown if this deletion affects plasmid function, but depositing lab was able to properly express proteins from the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1 CAG rtTA3 TauWT 2N4R-EGFP was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 132389 ; http://n2t.net/addgene:132389 ; RRID:Addgene_132389) -
For your References section:
Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies. Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G. Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5. 10.21769/BioProtoc.3615 PubMed 33659578