-
PurposeCre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepaavCAG
- Backbone size w/o insert (bp) 5000
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameimproved Cre recombinase
-
Alt nameiCre
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1056
-
GenBank IDAY056050
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcggctctagagcctctgcta
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
paavCAG-iCre was a gift from Jinhyun Kim (Addgene plasmid # 51904 ; http://n2t.net/addgene:51904 ; RRID:Addgene_51904) -
For your References section:
Structured Synaptic Connectivity between Hippocampal Regions. Druckmann S, Feng L, Lee B, Yook C, Zhao T, Magee JC, Kim J. Neuron. 2014 Feb 5;81(3):629-40. doi: 10.1016/j.neuron.2013.11.026. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.026 PubMed 24412418