Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #132393)


Item Catalog # Description Quantity Price (USD)
Plasmid 132393 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Total vector size (bp) 8048
  • Vector type
    Mammalian Expression, Cre/Lox, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Bacteria may truncate DNA, please select multiple clones and perform restriction digest after purification to confirm.
  • Copy number
    High Copy


  • Gene/Insert name
    human TauP301L 2N4R-EGFP
  • Species
    H. sapiens (human), Synthetic
  • Mutation
    Proline 301 to Leucine (P301L)
  • Entrez Gene
    MAPT (a.k.a. DDPAC, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, tau-40)
  • Promoter TREtight
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbvCI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TTCAGGTTGGACCGGTCCTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1 CAG rtTA3 TauP301L 2N4R-EGFP was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 132393 ; ; RRID:Addgene_132393)
  • For your References section:

    Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies. Wang X, Friesen E, Müller I, Lemieux M, Dukart R, Maia IB, Kalia S, and Schmitt-Ulms G. Bio-protocol. 2020; 10(9): e3615 10.21769/BioProtoc.3615