pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector
(Plasmid
#132560)
-
PurposeVector plasmid expressing ABEmax and sgRNA scaffold with com replacing the Tetraloop.
-
Depositing Lab
-
Depositing OrganizationWake Forest University Health Sciences
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 132560-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 132560-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameABEmax
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CMV-R: tgccaagtgggcagtttac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA, with Tetraloop replaced by com aptamer
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer LKO-F: GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 132560-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 132560-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector was a gift from Baisong Lu (Addgene plasmid # 132560 ; http://n2t.net/addgene:132560 ; RRID:Addgene_132560) -
For your References section:
Adenine Base Editor Ribonucleoproteins Delivered by Lentivirus-Like Particles Show High On-Target Base Editing and Undetectable RNA Off-Target Activities. Lyu P, Lu Z, Cho SI, Yadav M, Yoo KW, Atala A, Kim JS, Lu B. CRISPR J. 2021 Feb;4(1):69-81. doi: 10.1089/crispr.2020.0095. 10.1089/crispr.2020.0095 PubMed 33616436