Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shh10
(Plasmid #64867)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64867 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    XX2
  • Backbone manufacturer
    University of North Carolina Dr. Samulski
  • Backbone size w/o insert (bp) 5648
  • Total vector size (bp) 8182
  • Modifications to backbone
    replaced AAV2 cap with shh10 cap
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shh10 cap
  • Species
    Adeno-associated virus - 6
  • Insert Size (bp)
    2211
  • Mutation
    I319V, N451D, D532N

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCGGAAGCTTCGATCAACTACGC
  • 3′ sequencing primer GCAGTGCCAGGGTTGATTATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shh10 was a gift from John Flannery & David Schaffer (Addgene plasmid # 64867 ; http://n2t.net/addgene:64867 ; RRID:Addgene_64867)
  • For your References section:

    A novel adeno-associated viral variant for efficient and selective intravitreal transduction of rat Muller cells. Klimczak RR, Koerber JT, Dalkara D, Flannery JG, Schaffer DV. PLoS One. 2009 Oct 14;4(10):e7467. doi: 10.1371/journal.pone.0007467. 10.1371/journal.pone.0007467 PubMed 19826483