pXGFPC-5 Pxyl-dcas9 (Sth3)
(Plasmid
#133317)
-
Purposeexpresses dcas9 (Streptococcus thermophilus #3); repressed with 0.2% glucose, induced with 0.3% xylose; for homologous recombination at the xyl locus in Caulobacter crescentus; tetracycline resistance
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 133317-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 133317-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepXGFPC-5
- Backbone size w/o insert (bp) 6296
- Total vector size (bp) 10463
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedcas9 (Streptococcus thermophilus #3)
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)4167
- Promoter xylose
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGTCAGACAACCTACTTGCCGTC
- 3′ sequencing primer TCGGCTGCGGCGAGCGGTATCA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 133317-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 133317-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXGFPC-5 Pxyl-dcas9 (Sth3) was a gift from Michael Laub (Addgene plasmid # 133317 ; http://n2t.net/addgene:133317 ; RRID:Addgene_133317) -
For your References section:
A CRISPR Interference System for Efficient and Rapid Gene Knockdown in Caulobacter crescentus. Guzzo M, Castro LK, Reisch CR, Guo MS, Laub MT. mBio. 2020 Jan 14;11(1):e02415-19. doi: 10.1128/mBio.02415-19. 10.1128/mBio.02415-19 PubMed 31937638