Skip to main content

pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA1
(Plasmid #133340)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133340 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 133340-D50 50 μg of DNA in Tris buffer $495
DNA 133340-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBXMCS-2
  • Backbone size w/o insert (bp) 5287
  • Total vector size (bp) 5515
  • Modifications to backbone
    xylR operator removed
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA_gcrA
  • Species
    Streptococcus thermophilus
  • Insert Size (bp)
    270
  • Promoter constitutive

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCTGATCCTCGCCCGAAAC
  • 3′ sequencing primer TTTTCCCAGTCACGACGTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA1 was a gift from Michael Laub (Addgene plasmid # 133340 ; http://n2t.net/addgene:133340 ; RRID:Addgene_133340)
  • For your References section:

    A CRISPR Interference System for Efficient and Rapid Gene Knockdown in Caulobacter crescentus. Guzzo M, Castro LK, Reisch CR, Guo MS, Laub MT. mBio. 2020 Jan 14;11(1):e02415-19. doi: 10.1128/mBio.02415-19. 10.1128/mBio.02415-19 PubMed 31937638