pREP-8xARE-GFP-SV40-BFP
(Plasmid #134910)

• Purpose: NRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFP
• Depositing Lab: Markus Landthaler
• Publication: Wyler et al Nat Commun. 2019 Oct 25;10(1):4878. doi: 10.1038/s41467-019-12894-z.

Backbone

• Vector backbone: pMIR
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 8xARE- minimal promoter - GFP
• Species: Synthetic
• Promoter: 8xARE - minimal promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NdeI (not destroyed)
• 5′ sequencing primer: CGGATAACAATTTCACACAGG

Gene/Insert 2

• Gene/Insert name: TagBFP
• Species: Synthetic
• Promoter: SV40

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (destroyed during cloning)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: none
• 3′ sequencing primer: CACTGCATTCTAGTTGTGGTT

Resource Information

• Supplemental Documents:
  • pREP-ARE-GFP_BFP-24-1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry