Skip to main content

CAG-eGFP-Z1
(Plasmid #135046)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135046 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Z1
  • Backbone manufacturer
    Green lab
  • Backbone size w/o insert (bp) 3301
  • Total vector size (bp) 4021
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Alt name
    Enhanced green fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter CAG Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ggccatttaccgtaagttatgt
  • 3′ sequencing primer gcgatgactaatacgtagatgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-eGFP-Z1 was a gift from Jordan Green (Addgene plasmid # 135046 ; http://n2t.net/addgene:135046 ; RRID:Addgene_135046)
  • For your References section:

    Engineering of episomal plasmid structure to enhance non-viral Poly(beta-amino ester) nanoparticle gene delivery to liver and brain cancer cells. Yang J, Kollings J, Idnani E, Wilson DR, Cozzone IG, Mendes S, Varanasi M, Tzeng SY, Green JJ. PLoS One. 2026 Jul 23;21(7):e0352468. doi: 10.1371/journal.pone.0352468. eCollection 2026. 10.1371/journal.pone.0352468 PubMed 42490567