-
PurposeEnhanced Green fluorescent protein expression for mammalian cells under constitutive CMV Promoter in minimal backbone plasmid.
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 135049-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 135049-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneZ1
-
Backbone manufacturerGreen Lab
- Backbone size w/o insert (bp) 2226
- Total vector size (bp) 2946
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameEnhanced Green Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CMV Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer cacgcctaccgcccatttgcg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 135049-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 135049-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-eGFP-Z1 was a gift from Jordan Green (Addgene plasmid # 135049 ; http://n2t.net/addgene:135049 ; RRID:Addgene_135049) -
For your References section:
Engineering of episomal plasmid structure to enhance non-viral Poly(beta-amino ester) nanoparticle gene delivery to liver and brain cancer cells. Yang J, Kollings J, Idnani E, Wilson DR, Cozzone IG, Mendes S, Varanasi M, Tzeng SY, Green JJ. PLoS One. 2026 Jul 23;21(7):e0352468. doi: 10.1371/journal.pone.0352468. eCollection 2026. 10.1371/journal.pone.0352468 PubMed 42490567