-
Purpose3xFLAG 2xVP64 SadCas9 for single guide cloning
-
Depositing Lab
-
Depositing OrganizationHospital for Sick Children
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 135338-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 135338-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX601
-
Backbone manufacturerAddgene (61591)
- Backbone size w/o insert (bp) 4010
- Total vector size (bp) 7667
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSadCas9
-
Alt namedSauCas9
-
Alt namedSaCas9
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)3405
-
MutationD10A and N580A
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFLAG-VP64-SV40 NLS (N terminal on insert)
- NLS-VP64 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
- 3′ sequencing primer CTTTCAAGTTACGGTAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byN/A
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 135338-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 135338-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3XFLAG-VP64-SadCas9-NLS-VP64 was a gift from Ronald Cohn (Addgene plasmid # 135338 ; http://n2t.net/addgene:135338 ; RRID:Addgene_135338) -
For your References section:
A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277
Map uploaded by the depositor.
