Skip to main content
Addgene
Open Menu

pINTO-N3::hTET3 HxD
(Plasmid #136365)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136365 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 136365-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 136365-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pINTO-N3
  • Backbone manufacturer
    BonasioLab
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 12300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TET3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5400
  • Mutation
    HxD (H1077Y, D1079A)
  • GenBank ID
    NP_001274420.1
  • Entrez Gene
    TET3 (a.k.a. BEFAHRS, hCG_40738)
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • HA (N terminal on backbone)
    • 2xStrepTagII (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINTO-N3::hTET3 HxD was a gift from Roberto Bonasio (Addgene plasmid # 136365 ; http://n2t.net/addgene:136365 ; RRID:Addgene_136365)

  • For your References section:

    Delineation of a Human Mendelian Disorder of the DNA Demethylation Machinery: TET3 Deficiency. Beck DB, Petracovici A, He C, Moore HW, Louie RJ, Ansar M, Douzgou S, Sithambaram S, Cottrell T, Santos-Cortez RLP, Prijoles EJ, Bend R, Keren B, Mignot C, Nougues MC, Ounap K, Reimand T, Pajusalu S, Zahid M, Saqib MAN, Buratti J, Seaby EG, McWalter K, Telegrafi A, Baldridge D, Shinawi M, Leal SM, Schaefer GB, Stevenson RE, Banka S, Bonasio R, Fahrner JA. Am J Hum Genet. 2020 Jan 3. pii: S0002-9297(19)30471-9. doi: 10.1016/j.ajhg.2019.12.007. 10.1016/j.ajhg.2019.12.007 PubMed 31928709
Related items:
Commonly requested with: