Skip to main content
Addgene
Open Menu

AAVS1-Puro Xlone-eGFP
(Plasmid #136936)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136936 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 136936-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 136936-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    AAVS1
  • Backbone size w/o insert (bp) 10272
  • Total vector size (bp) 10989
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    all-in-one tet-on system
  • Alt name
    Xlone
  • Species
    Synthetic
  • Insert Size (bp)
    2474
  • Promoter TRE3GS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer cgcctgtcttaggttggagt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Xlone-GFP was cloned from Addgene #96930, a gift from Dr. Xiaojun Lian Lab

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid is identical to Addgene plasmid # 179837 except this plasmid contains a WPRE sequence and plasmid 179837 does not.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Puro Xlone-eGFP was a gift from Xiaoping Bao (Addgene plasmid # 136936 ; http://n2t.net/addgene:136936 ; RRID:Addgene_136936)

  • For your References section:

    Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells. Chang Y, Hellwarth PB, Randolph LN, Sun Y, Xing Y, Zhu W, Lian XL, Bao X. Biotechnol Bioeng. 2020 Apr 11. doi: 10.1002/bit.27352. 10.1002/bit.27352 PubMed 32277708
Related items:
Commonly requested with: