pBB0238-TEV-His12
(Plasmid #137038)

• Purpose: expression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0238 with C-terminal TEV-protease-cleavable His12
• Depositing Lab: Debra Hansen
• Publication: Robertson et al Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Backbone

• Vector backbone: pRSET-TEV-12His
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAC66635.2
• Alt name: BB0238
• Species: Borrelia burgdorferi B31
• Mutation: wild type, full-length protein, contains signal peptide
• Promoter: T7
• Tag / Fusion Protein:
  • His12 (TEV protease cleavable) (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pBB0238-TEV-His12.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid uses the T7 promoter to express in E. coli the full-length, wild-type protein containing a C-terminal TEV-protease-cleavable His12-tag. The protein sequence includes its N-terminal membrane-targeting signal peptide sequence. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.