pelB-MBP-HtrA-ss
(Plasmid #137066)

• Purpose: E. coli expression clone (T7lac promoter) for mature HtrA (aa 28-474) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage
• Depositing Lab: Debra Hansen
• Publication: Robertson et al Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Backbone

• Vector backbone: pelB-MBP (DNASU access no. EvNO00813783)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: AAC66500.2
• Alt name: HtrA BbHtrA BB0104
• Species: Borrelia burgdorferi B31
• Mutation: mature HtrA: lacks the HtrA signal peptide
• Entrez Gene: BB_0104 (a.k.a. BB_0104)
• Promoter: T7lac
• Tag / Fusion Protein:
  • PelB signal peptide + His10 + maltose binding protein + TEV protease cleavage (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GAAAGGTGAAATCATGCCGAACATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pelB-MBP-HtrA-ss.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid uses the T7lac promoter to express in E. coli the mature (lacking the signal peptide), wild-type protein containing an N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage site. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli. After TEV cleavage, the target protein has an added A residue at the N-terminus of the mature protein.