pUC57-BBclone1
(Plasmid #137069)

• Purpose: E. coli plasmid that contains the expression optimized genes for BB0405, BB0406, P66, BBA57, HtrA, RevA and BB0238
• Depositing Lab: Debra Hansen
• Publication: Robertson et al Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Backbone

• Vector backbone: pUC57
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: BB0405
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66795.1
• Entrez Gene: BB_0405 (a.k.a. BB_0405)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG

Gene/Insert 2

• Gene/Insert name: BB0406
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66794.1

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTGCTGGGCAGCCCGATGAG

Gene/Insert 3

• Gene/Insert name: P66
• Alt name: BB0603
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66949.1

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGACCAAACCGAGCATTCTG

Gene/Insert 4

• Gene/Insert name: BBA57
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66270.1

Cloning Information for Gene/Insert 4

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ACCAACAACGCGGCGATTGG

Gene/Insert 5

• Gene/Insert name: HtrA
• Alt name: BbHtrA BB0104
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66500.2

Cloning Information for Gene/Insert 5

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCAAAATCATTAACGCGACC

Gene/Insert 6

• Gene/Insert name: RevA
• Alt name: Bbm27 Bbp27 AAF07538.1
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAF07416.1
• Entrez Gene: revA (a.k.a. BB_M27)

Cloning Information for Gene/Insert 6

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAGCAAAAGCGTGAGCAACC

Gene/Insert 7

• Gene/Insert name: BB0238
• Species: Borrelia burgdorferi B31
• Mutation: wild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
• GenBank ID: AAC66635.2

Cloning Information for Gene/Insert 7

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GTAACGGCGATAAGATGAGC

Resource Information

• Supplemental Documents:
  • pUC57-BBclone1 INSERT.gb
• A portion of this plasmid was derived from a plasmid made by: ordered from GenScript synthesis of the expression-optimized genes

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For use as a PCR template for the expression optimized genes encoding BB0405, BB0406, P66, BBA57, BbHtrA, RevA, BB0238