pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
(Plasmid #138524)

• Purpose: Expresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt PRC2-binding G-tract repeat RNA sequence.
• Depositing Lab: Richard Jenner
• Publication: Beltran et al Nat Struct Mol Biol. 2019 Oct;26(10):899-909. doi: 10.1038/s41594-019-0293-z. Epub 2019 Sep 23.

Backbone

• Vector backbone: pLKO.1-puro U6 sgRNA BfuA1 stuffer
• Backbone size w/o insert (bp): 7145
• Total vector size (bp): 7423
• Modifications to backbone: Insertion of a spacer and G-tract repeat RNA sequence
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PRC2-binding G-tract repeat RNA
• Species: Synthetic
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTGACGTAGAAAGTAATAATTTC
• 3′ sequencing primer: CCTCGAGCCGCGGCCAAAG

Resource Information

• Supplemental Documents:
  • pLKO Puro U6 sgRNA BfuAI stuffer G-tract.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry