pTFUbiCre
(Plasmid #139670)

• Purpose: Expression cassette for Cre recombinase in T-DNA vector
• Depositing Lab: James Birchler
• Publication: Recombinase Expression Plasmids and Anti-DsRed test constructs for expression plasmids (unpublished)

Backbone

• Vector backbone: pTF101
  (Search Vector Database)
• Backbone size w/o insert (bp): 9189
• Total vector size (bp): 12635
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cre recombinase
• Species: bacteriophage p1
• Insert Size (bp): 1032
• Promoter: Maize Ubiquitin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATGCTCACCCTGTTGTTTGGTGT
• 3′ sequencing primer: AACGTGGGTAGCACCAAAAC

Resource Information

• Supplemental Documents:
  • pTFUbiCre.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation A207T in Cre