Skip to main content

pscPP7(2xWT)-EGFP
(Plasmid #140261)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140261 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 140261-D50 50 μg of DNA in Tris buffer $495
DNA 140261-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Two PP7CP-binding sites embedded in scaffold
  • Alt name
    scPP7(2xWT)
  • Species
    Synthetic
  • Insert Size (bp)
    79
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

scPP7(2xWT) motif was inserted between BamHI and AgeI sites of pAptamerCassette-EGFP (ID: 140288).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pscPP7(2xWT)-EGFP was a gift from Hirohide Saito (Addgene plasmid # 140261 ; http://n2t.net/addgene:140261 ; RRID:Addgene_140261)
  • For your References section:

    Orthogonal Protein-Responsive mRNA Switches for Mammalian Synthetic Biology. Ono H, Kawasaki S, Saito H. ACS Synth Biol. 2020 Jan 17;9(1):169-174. doi: 10.1021/acssynbio.9b00343. Epub 2019 Dec 13. 10.1021/acssynbio.9b00343 PubMed 31765565